• IB
  • IB Docs (2) Team
    Logout
  • Maths
  • Biology
  • Chemistry
  • Physics
  • Combined Science
  • English Language
  • Geography
  • Other Subjects
GCSE Maths
Edexcel Topic QuestionsRevision NotesPast PapersPast Papers Questions
AQA Topic QuestionsRevision NotesPast Papers
OCR Topic QuestionsRevision NotesPast Papers
GCSE Biology
Edexcel Topic QuestionsRevision NotesPast Papers
AQA Topic QuestionsRevision NotesPast Papers
OCR Gateway Topic QuestionsRevision NotesPast Papers
GCSE Chemistry
Edexcel Topic QuestionsRevision NotesPast Papers
AQA Topic QuestionsRevision NotesPast Papers
OCR Gateway Topic QuestionsRevision NotesPast Papers
GCSE Physics
Edexcel Topic QuestionsRevision NotesPast Papers
AQA Topic QuestionsRevision NotesPast Papers
OCR Gateway Topic QuestionsRevision NotesPast Papers
GCSE Combined Science
Edexcel Combined: Biology Topic QuestionsRevision NotesPast Papers
Edexcel Combined: Chemistry Topic QuestionsRevision NotesPast Papers
Edexcel Combined: Physics Revision NotesPast Papers
AQA Combined: Biology Topic QuestionsRevision NotesPast Papers
AQA Combined: Chemistry Topic QuestionsRevision NotesPast Papers
AQA Combined: Physics Topic QuestionsRevision NotesPast Papers
OCR Gateway Combined: Biology Topic QuestionsRevision Notes
OCR Gateway Combined: Chemistry Revision Notes
OCR Gateway Combined: Physics Revision Notes
GCSE English Language
AQA Revision NotesPractice PapersPast Papers
Edexcel Past Papers
OCR Past Papers
GCSE Geography
AQA Topic QuestionsRevision Notes
Edexcel Topic Questions
GCSE Other Subjects
AQA English LiteratureBusinessComputer ScienceEconomicsFurther MathsGeographyHistoryPsychologySociologyStatistics
Edexcel English LiteratureBusinessComputer ScienceGeographyHistoryPsychologyStatistics
OCR English LiteratureBusinessComputer ScienceEconomicsPsychology
OCR Gateway GeographyHistory
  • Maths
  • Biology
  • Chemistry
  • Physics
  • Double Science
  • Economics
  • English Language
  • Geography
  • Other Subjects
IGCSE Maths
Edexcel Topic QuestionsRevision NotesPast PapersBronze-Silver-Gold Questions
CIE (Extended) Topic QuestionsRevision NotesPast Papers
CIE (Core) Topic QuestionsPast Papers
IGCSE Biology
Edexcel Topic QuestionsRevision NotesPast Papers
CIE 2020-2022 Topic QuestionsRevision NotesPast Papers
CIE 2023-2025 Topic QuestionsRevision NotesPast Papers
IGCSE Chemistry
Edexcel Topic QuestionsRevision NotesPast Papers
CIE 2020-2022 Topic QuestionsRevision NotesPast Papers
CIE 2023-2025 Topic QuestionsRevision NotesPast Papers
IGCSE Physics
Edexcel Topic QuestionsRevision NotesPast Papers
CIE 2020-2022 Topic QuestionsRevision NotesPast Papers
CIE 2023-2025 Topic QuestionsRevision NotesPast Papers
IGCSE Double Science
Edexcel Double: Biology Topic QuestionsRevision NotesPast Papers
Edexcel Double: Chemistry Topic QuestionsRevision NotesPast Papers
Edexcel Double: Physics Topic QuestionsRevision NotesPast Papers
IGCSE Economics
CIE Topic QuestionsRevision NotesPast Papers
IGCSE English Language
CIE Revision NotesPractice PapersPast Papers
Edexcel Past Papers
IGCSE Geography
CIE Revision NotesTopic QuestionsPast Papers
Edexcel Topic QuestionsRevision NotesPast Papers
IGCSE Other Subjects
CIE Additional MathsEnglish LiteratureBusinessComputer ScienceHistorySociology
Edexcel English LiteratureBusinessComputer ScienceHistoryFurther Maths
  • Maths
  • Biology
  • Chemistry
  • Physics
  • English Language
  • Other Subjects
AS Maths
Edexcel Pure MathsMechanicsStatistics
AQA Pure MathsMechanicsStatistics
OCR Pure MathsMechanicsStatistics
CIE Pure 1Pure 2MechanicsProbability & Statistics 1
Edexcel IAS Pure 1Pure 2MechanicsStatistics
AS Biology
AQA Topic QuestionsRevision NotesPast Papers
OCR Topic QuestionsRevision NotesPast Papers
CIE 2019-2021 Topic QuestionsRevision NotesPast Papers
CIE 2022-2024 Topic QuestionsRevision NotesPast Papers
Edexcel IAL Revision Notes
AS Chemistry
Edexcel Revision Notes
AQA Topic QuestionsRevision NotesPast Papers
OCR Revision Notes
CIE 2019-2021 Topic QuestionsRevision NotesPast Papers
CIE 2022-2024 Topic QuestionsRevision NotesPast Papers
Edexcel IAL Revision Notes
AS Physics
Edexcel Revision Notes
AQA Topic QuestionsRevision NotesPast Papers
OCR Revision NotesPast Papers
CIE 2019-2021 Topic QuestionsRevision NotesPast Papers
CIE 2022-2024 Topic QuestionsRevision NotesPast Papers
Edexcel IAL Revision Notes
AS English Language
AQA Past Papers
Edexcel Past Papers
OCR Past Papers
AS Other Subjects
AQA BusinessComputer ScienceEconomicsEnglish LiteratureFurther MathsGeographyHistoryPsychologySociology
Edexcel BusinessEconomicsEnglish LiteratureFurther MathsGeographyHistoryPsychology
OCR BusinessComputer ScienceEconomicsEnglish LiteratureFurther Maths AGeographyHistoryPsychologySociology
CIE Further Maths
  • Maths
  • Biology
  • Chemistry
  • Physics
  • English Language
  • Economics
  • Further Maths
  • Psychology
  • Other Subjects
A Level Maths
Edexcel Pure MathsMechanicsStatistics
AQA Pure MathsMechanicsStatistics
OCR Pure MathsMechanicsStatistics
CIE Pure 1Pure 3MechanicsProbability & Statistics 1Probability & Statistics 2
Edexcel IAL Pure 1Pure 2Pure 3Pure 4Mechanics 1Mechanics 2Statistics 1Statistics 2Decision 1
A Level Biology
Edexcel Topic QuestionsPast Papers
Edexcel A (SNAB) Revision Notes
AQA Topic QuestionsRevision NotesPast Papers
OCR Topic QuestionsRevision NotesPast PapersGold Questions
CIE 2019-2021 Topic QuestionsRevision NotesPast Papers
CIE 2022-2024 Topic QuestionsRevision NotesPast Papers
Edexcel IAL Topic QuestionsRevision NotesPast Papers
A Level Chemistry
Edexcel Topic QuestionsRevision NotesPast Papers
AQA Topic QuestionsRevision NotesPast Papers
OCR Topic QuestionsRevision NotesPast PapersGold Questions
CIE 2019-2021 Topic QuestionsRevision NotesPast Papers
CIE 2022-2024 Topic QuestionsRevision NotesPast Papers
Edexcel IAL Topic QuestionsRevision NotesPast Papers
A Level Physics
Edexcel Topic QuestionsRevision NotesPast Papers
AQA Topic QuestionsRevision NotesPast Papers
OCR Topic QuestionsRevision NotesPast Papers
CIE 2019-2021 Topic QuestionsRevision NotesPast Papers
CIE 2022-2024 Topic QuestionsRevision NotesPast Papers
Edexcel IAL Topic QuestionsRevision NotesPast Papers
A Level English Language
AQA Past Papers
CIE Past Papers
Edexcel Past Papers
OCR Past Papers
Edexcel IAL Past Papers
A Level Economics
Edexcel Topic QuestionsRevision NotesPast Papers
AQA Topic QuestionsPast Papers
OCR Past Papers
CIE Past Papers
A Level Further Maths
Edexcel Topic QuestionsRevision NotesPast Papers
AQA Past Papers
OCR Past Papers
CIE Past Papers
Edexcel IAL Past Papers
A Level Psychology
AQA Topic QuestionsRevision NotesPast Papers
CIE Past Papers
Edexcel Past Papers
OCR Past Papers
Edexcel IAL Past Papers
A Level Other Subjects
AQA BusinessComputer ScienceEconomicsEnglish LiteratureGeographyHistorySociology
CIE BusinessComputer ScienceEconomicsEnglish LiteratureGeographySociology
Edexcel BusinessEconomics AEnglish LiteratureGeographyHistory
OCR BusinessComputer ScienceEconomicsEnglish LiteratureGeographyHistorySociology
Edexcel IAL English LiteratureGeography
CIE IAL History
  • Biology
  • Chemistry
  • Physics
  • Other Subjects
O Level Biology
CIE Topic QuestionsPast Papers
O Level Chemistry
CIE Topic QuestionsPast Papers
O Level Physics
CIE Topic QuestionsPast Papers
O Level Other Subjects
CIE Additional MathsMaths D
  • Maths
  • Biology
  • Chemistry
  • Physics
Pre U Maths
CIE Topic QuestionsPast Papers
Pre U Biology
CIE Topic QuestionsPast Papers
Pre U Chemistry
CIE Topic QuestionsPast Papers
Pre U Physics
CIE Topic QuestionsPast Papers
  • Maths
  • Biology
  • Chemistry
  • Physics
  • Economics
IB Maths
Maths: AA HL Topic QuestionsRevision NotesPractice Papers
Maths: AI HL Topic QuestionsRevision NotesPractice Papers
Maths: AA SL Topic QuestionsRevision NotesPractice Papers
Maths: AI SL Topic QuestionsRevision NotesPractice Papers
IB Biology
Biology: SL Topic QuestionsRevision NotesPractice Papers
Biology: HL Topic QuestionsRevision NotesPractice Papers
IB Chemistry
Chemistry: SL Topic QuestionsRevision NotesPractice Papers
Chemistry: HL Topic QuestionsRevision NotesPractice Papers
IB Physics
Physics: SL Topic QuestionsRevision NotesPractice Papers
Physics: HL Topic QuestionsRevision NotesPractice Papers
IB Economics
Economics: SL Revision Notes

DP IB Biology: HL

Revision Notes

Home / IB / Biology: HL / DP / Revision Notes / 2. Molecular Biology / 2.6 Transcription & Translation / 2.6.5 Skills: Interpreting Sequences


2.6.5 Skills: Interpreting Sequences


Determination of mRNA Base Sequence

  • The rules of base pairing and the table of mRNA codons are needed to be able to convert between DNA sequences, mRNA base sequences and amino acid sequences
  • A triplet is a sequence of three DNA bases that codes for a specific amino acid
  • A codon is a sequence of three mRNA bases that codes for a specific amino acid
  • A codon is transcribed from the triplet and is complementary to it
  • When comparing the genetic code to amino acid sequences, mRNA codons are often used
  • The four bases found in RNA molecules (adenine, uracil, cytosine and guanine) have the ability to form 64 different codons
  • Multiple mRNA codons can encode the same amino acid
    • This means that a change in the genetic code doesn’t necessarily result in a change in the amino acid sequence
      • For example, UGU and UGC both code for the amino acid, cysteine

  • Some send important signals to the transcription machinery
    • The START codon initiates the process of transcription and ensures it starts in the right location (this is always the amino acid methionine in eukaryotic cells, coded for by the codon AUG)
    • STOP codons cause transcription to terminate and do not code for an amino acid e.g. UAA

  • The genetic code is non-overlapping
    • Each base is only read once in the codon it is part of

The rules of base pairing

  • In DNA,
    • Adenine (A) always pairs with Thymine (T)
    • Cytosine (C) always pairs with Guanine (G)

  • In RNA, Thymine (T) is replaced by Uracil (U)
    • This means that the base Adenine (A) in DNA is transcribed to Uracil (U) in the mRNA strand

The mRNA Codons and Amino Acids table

  • The first three bases of an mRNA strand form the first codon
  • The first base of the codon is read from the first column of the table
  • The second base of the codon is read from the top row of the table
  • The third base of the codon is read from the final column of the table

mRNA Codons and Amino Acids Table

mRNA Codons and Amino Acids Table, downloadable AS & A Level Biology revision notes

Intrepreting the Genetic Code

  • Use a table of the genetic code to deduce which codon(s) corresponds to which amino acid
  • The 20 amino acids are all coded for in the Table of mRNA Codons
  • Some amino acids are only coded for by one codon eg. methionine (Met), coded by AUG
  • Other amino acids have several codons that code for them eg. arginine (Arg), coded by CGU, CGC, CGA, CGG, AGA and AGG

Worked Example

Use the table of mRNA Codons and Amino Acids to identify the mRNA codons that code for the following amino acids:

  1. Histidine (His)
  2. Tryptophan (Trp)
  3. Glycine (Gly)
  4. Leucine (Leu)

Step 1: Look up His in the table

Codon CAU (no others)

Step 2: Look up Trp in the table

Codon UGG (no others)

Step 3: Look up Gly in the table

Codons GGU, GGC, GGA and GGG

Step 4: Look up Leu in the table

Codons CUU, CUC, CUA, CUG, UUA, UUG

Deducing the Sequences

  • Use a table of mRNA codons and their corresponding amino acids to deduce the sequence of amino acids coded by a short mRNA strand of a known base sequence

Worked Example

Deduce the amino acid sequence coded for by the mRNA sequenceAUGACUGGGCCUCCCCAAUAUUAG

Step 1: split the mRNA sequence into triplets

AUG ACU GGG CCU CCC CAA UAU UAG

Step 2: look up the first triplet in the mRNA Codons and Amino Acids Table:

AUG = Met

Step 3: repeat for the remaining triplets

ACU = Thr

GGG = Gly

CCU = Pro

CCC = Pro

CAA = Gln

UAU = Tyr

UAG = Stop

Step 4 : link the amino acids together

Met-Thr-Gly-Pro-Pro-Gln-Tyr

Exam Tip

In an exam, you may be asked to predict the effect of specific mutations in the genetic code. Remember that the genetic code allows more than one amino acid to be coded for by triplets and is non-overlapping!You will not be required to memorise specific codons and the amino acids that they code for.



  • 1. Cell Biology
    • 1.1 Cells: Theory
      • 1.1.1 Cell Theory
        • 1.1.2 Functions of Life
          • 1.1.3 Surface Area to Volume Ratio
            • 1.1.4 Cell Specialisation
              • 1.1.5 Stem Cells
                • 1.1.6 Skills: Cell Theory
                • 1.2 Cells: Origin & Ultrastructure
                  • 1.2.1 Origin of Cells
                    • 1.2.2 Endosymbiotic Theory
                      • 1.2.3 Prokaryotic Cell Structure
                        • 1.2.4 Eukaryotic Cell Structure
                          • 1.2.5 Exocrine Pancreatic & Palisade Mesophyll Cells
                            • 1.2.6 Comparison of Prokaryotic & Eukaryotic Cells
                              • 1.2.7 Microscopes
                                • 1.2.8 Skills: Drawing Cells
                                  • 1.2.9 Skills: Cell Origin & Ultrastructure
                                  • 1.3 Cells: Membrane Structure & Transport
                                    • 1.3.1 Phospholipid Bilayer Properties
                                      • 1.3.2 Membrane Proteins
                                        • 1.3.3 History of Fluid Mosaic Model
                                          • 1.3.4 Membrane Transport
                                            • 1.3.5 Active Transport & Bulk Transport
                                              • 1.3.6 Skills: Membrane Structure & Transport
                                                • 1.3.7 Skills: Estimation of Osmolarity
                                                • 1.4 Cells: Division
                                                  • 1.4.1 Cell Cycle
                                                    • 1.4.2 Phases of Mitosis
                                                      • 1.4.3 Cancer
                                                        • 1.4.4 Skills: Cell Division
                                                      • 2. Molecular Biology
                                                        • 2.1 Metabolism & Water
                                                          • 2.1.1 Molecules
                                                            • 2.1.2 Metabolism
                                                              • 2.1.3 Hydrogen Bonds
                                                                • 2.1.4 Water
                                                                • 2.2 Carbohydrates & Lipids
                                                                  • 2.2.1 Carbohydrates
                                                                    • 2.2.2 Fatty Acids
                                                                      • 2.2.3 Lipids
                                                                        • 2.2.4 Skills: Visualising Carbohydrates
                                                                          • 2.2.5 Skills: Calculating BMI
                                                                          • 2.3 Proteins
                                                                            • 2.3.1 Proteins
                                                                              • 2.3.2 Protein Structure & Function
                                                                                • 2.3.3 The Variety of Proteins
                                                                                  • 2.3.4 Skills: Molecules
                                                                                  • 2.4 Enzymes
                                                                                    • 2.4.1 Enzymes
                                                                                      • 2.4.2 Immobilised Enzymes
                                                                                        • 2.4.3 Skills: Enzyme Experiments
                                                                                        • 2.5 Nucleic Acids: Structure & DNA Replication
                                                                                          • 2.5.1 DNA & RNA Structure
                                                                                            • 2.5.2 DNA Replication
                                                                                              • 2.5.3 Skills: DNA Replication
                                                                                              • 2.6 Transcription & Translation
                                                                                                • 2.6.1 Transcription
                                                                                                  • 2.6.2 Translation
                                                                                                    • 2.6.3 Biotechnology
                                                                                                      • 2.6.4 Skills: DNA, RNA & Protein Synthesis
                                                                                                        • 2.6.5 Skills: Interpreting Sequences
                                                                                                        • 2.7 Cellular Respiration
                                                                                                          • 2.7.1 Cellular Respiration
                                                                                                            • 2.7.2 Anaerobic Respiration
                                                                                                              • 2.7.3 Aerobic Respiration
                                                                                                                • 2.7.4 Skills: Respiration
                                                                                                                • 2.8 Photosynthesis
                                                                                                                  • 2.8.1 Photosynthesis
                                                                                                                    • 2.8.2 Photosynthesis Continued
                                                                                                                      • 2.8.3 Skills: Photosynthesis
                                                                                                                        • 2.8.4 Skills: Separating Photosynthetic Pigments
                                                                                                                      • 3. Genetics
                                                                                                                        • 3.1 Genes & Chromosomes
                                                                                                                          • 3.1.1 Genes
                                                                                                                            • 3.1.2 Alleles
                                                                                                                              • 3.1.3 Mutation
                                                                                                                                • 3.1.4 Genome
                                                                                                                                  • 3.1.5 Prokaryotic Chromosomes
                                                                                                                                    • 3.1.6 Eukaryotic Chromosomes
                                                                                                                                      • 3.1.7 Chromosome Number
                                                                                                                                        • 3.1.8 Sex Determination
                                                                                                                                          • 3.1.9 Karyograms
                                                                                                                                            • 3.1.10 Skills: Using Databases
                                                                                                                                            • 3.2 Meiosis
                                                                                                                                              • 3.2.1 Meiosis
                                                                                                                                                • 3.2.2 Stages of Meiosis
                                                                                                                                                  • 3.2.3 Genetic Variation
                                                                                                                                                    • 3.2.4 Non-disjunction
                                                                                                                                                      • 3.2.5 Skills: Meiosis
                                                                                                                                                      • 3.3 Inheritance
                                                                                                                                                        • 3.3.1 Inheritance
                                                                                                                                                          • 3.3.2 Inheriting Alleles
                                                                                                                                                            • 3.3.3 Skills: Inheritance
                                                                                                                                                              • 3.3.4 Inheritance of Genetic Diseases
                                                                                                                                                                • 3.3.5 Mutations & Disease
                                                                                                                                                                • 3.4 Genetic Modification & Biotechnology
                                                                                                                                                                  • 3.4.1 Electrophoresis & PCR
                                                                                                                                                                    • 3.4.2 DNA Profiling
                                                                                                                                                                      • 3.4.3 Genetic Modification
                                                                                                                                                                        • 3.4.4 Cloning
                                                                                                                                                                          • 3.4.5 Skills: Genetic Modification & Biotechnology
                                                                                                                                                                        • 4. Ecology
                                                                                                                                                                          • 4.1 Species, Communities, Ecosystems & Energy Flow
                                                                                                                                                                            • 4.1.1 Species & Population
                                                                                                                                                                              • 4.1.2 Methods of Nutrition
                                                                                                                                                                                • 4.1.3 Community
                                                                                                                                                                                  • 4.1.4 Nutrient Cycling
                                                                                                                                                                                    • 4.1.5 Energy Flow
                                                                                                                                                                                      • 4.1.6 Energy Losses
                                                                                                                                                                                        • 4.1.7 Skills: Species, Communities, Ecosystems & Energy Flow
                                                                                                                                                                                          • 4.1.8 Skills: Chi-squared test & Statistical Significance
                                                                                                                                                                                            • 4.1.9 Skills: Pyramids of Energy
                                                                                                                                                                                            • 4.2 Carbon Cycling & Climate Change
                                                                                                                                                                                              • 4.2.1 Carbon Cycle: Carbon Dioxide
                                                                                                                                                                                                • 4.2.2 Carbon Cycle: Carbon Dioxide in the Atmosphere
                                                                                                                                                                                                  • 4.2.3 Carbon Cycle: Methane
                                                                                                                                                                                                    • 4.2.4 Carbon Cycle: Organic Matter
                                                                                                                                                                                                      • 4.2.5 Climate Change: Greenhouse Effect
                                                                                                                                                                                                        • 4.2.6 Climate Change: Impact
                                                                                                                                                                                                          • 4.2.7 Climate Change: Causes
                                                                                                                                                                                                            • 4.2.8 Skills: Carbon Cycling & Climate Change
                                                                                                                                                                                                          • 5. Evolution and Biodiversity
                                                                                                                                                                                                            • 5.1 Evolution & Natural Selection
                                                                                                                                                                                                              • 5.1.1 Evolution
                                                                                                                                                                                                                • 5.1.2 Evolution: Evidence
                                                                                                                                                                                                                  • 5.1.3 Variation
                                                                                                                                                                                                                    • 5.1.4 Natural Selection
                                                                                                                                                                                                                      • 5.1.5 Natural Selection Examples
                                                                                                                                                                                                                      • 5.2 Classification & Cladistics
                                                                                                                                                                                                                        • 5.2.1 Classification System
                                                                                                                                                                                                                          • 5.2.2 Classifying Organisms
                                                                                                                                                                                                                            • 5.2.3 Plant Phyla Features
                                                                                                                                                                                                                              • 5.2.4 Animal Phyla Features
                                                                                                                                                                                                                                • 5.2.5 Cladistics
                                                                                                                                                                                                                                  • 5.2.6 Reclassification
                                                                                                                                                                                                                                    • 5.2.7 Skills: Classification & Cladistics
                                                                                                                                                                                                                                  • 6. Human Physiology
                                                                                                                                                                                                                                    • 6.1 Digestion & Absorption
                                                                                                                                                                                                                                      • 6.1.1 Digestion
                                                                                                                                                                                                                                        • 6.1.2 Villi & Absorption
                                                                                                                                                                                                                                          • 6.1.3 Absorption
                                                                                                                                                                                                                                            • 6.1.4 Skills: Digestion & Absorption
                                                                                                                                                                                                                                            • 6.2 The Blood System
                                                                                                                                                                                                                                              • 6.2.1 The Blood System: History
                                                                                                                                                                                                                                                • 6.2.2 The Blood System: Vessels
                                                                                                                                                                                                                                                  • 6.2.3 The Blood System: Double Circulation
                                                                                                                                                                                                                                                    • 6.2.4 The Blood System: Cardiac Cycle
                                                                                                                                                                                                                                                      • 6.2.5 The Heart Rate
                                                                                                                                                                                                                                                        • 6.2.6 Skills: The Blood System
                                                                                                                                                                                                                                                        • 6.3 Defence Against Infectious Disease
                                                                                                                                                                                                                                                          • 6.3.1 Skin
                                                                                                                                                                                                                                                            • 6.3.2 Blood Clotting
                                                                                                                                                                                                                                                              • 6.3.3 White Blood Cells
                                                                                                                                                                                                                                                                • 6.3.4 Antibiotics
                                                                                                                                                                                                                                                                  • 6.3.5 Antibiotic Resistance
                                                                                                                                                                                                                                                                  • 6.4 Gas Exchange
                                                                                                                                                                                                                                                                    • 6.4.1 Ventilation: Function & Structures
                                                                                                                                                                                                                                                                      • 6.4.2 Ventilation: Mechanism
                                                                                                                                                                                                                                                                        • 6.4.3 Lung Diseases
                                                                                                                                                                                                                                                                          • 6.4.4 Skills: Monitoring Ventilation
                                                                                                                                                                                                                                                                          • 6.5 Neurones & Synapses
                                                                                                                                                                                                                                                                            • 6.5.1 Neurones: Function & Structure
                                                                                                                                                                                                                                                                              • 6.5.2 Nerve Impulses
                                                                                                                                                                                                                                                                                • 6.5.3 Synapses
                                                                                                                                                                                                                                                                                  • 6.5.4 Skill: Neurones & Synapses
                                                                                                                                                                                                                                                                                  • 6.6 Hormones, Homeostasis & Reproduction
                                                                                                                                                                                                                                                                                    • 6.6.1 Hormones
                                                                                                                                                                                                                                                                                      • 6.6.2 Hormones Continued
                                                                                                                                                                                                                                                                                        • 6.6.3 Reproduction: Background
                                                                                                                                                                                                                                                                                          • 6.6.4 Reproduction: Sex Determination in Males
                                                                                                                                                                                                                                                                                            • 6.6.5 Reproduction: Sex Determination in Females
                                                                                                                                                                                                                                                                                              • 6.6.6 Skills: Reproduction Diagrams
                                                                                                                                                                                                                                                                                            • 7. Nucleic Acids (HL Only)
                                                                                                                                                                                                                                                                                              • 7.1 DNA Structure & Replication
                                                                                                                                                                                                                                                                                                • 7.1.1 DNA Structure
                                                                                                                                                                                                                                                                                                  • 7.1.2 Mechanism of DNA Replication
                                                                                                                                                                                                                                                                                                    • 7.1.3 Non-coding DNA
                                                                                                                                                                                                                                                                                                      • 7.1.4 DNA Sequencing
                                                                                                                                                                                                                                                                                                        • 7.1.5 Skills: The Hershey & Chase Experiment
                                                                                                                                                                                                                                                                                                          • 7.1.6 Skills: Nucleosomes & Molecular Visualisation Software
                                                                                                                                                                                                                                                                                                          • 7.2 Transcription & Gene Expression
                                                                                                                                                                                                                                                                                                            • 7.2.1 Regulation of Gene Expression by Proteins
                                                                                                                                                                                                                                                                                                              • 7.2.2 Environment & Gene Expression
                                                                                                                                                                                                                                                                                                                • 7.2.3 Transcription
                                                                                                                                                                                                                                                                                                                  • 7.2.4 Post-transcriptional Modification
                                                                                                                                                                                                                                                                                                                    • 7.2.5 Skills: Analysing DNA Methylation Patterns
                                                                                                                                                                                                                                                                                                                    • 7.3 Translation
                                                                                                                                                                                                                                                                                                                      • 7.3.1 Translation
                                                                                                                                                                                                                                                                                                                        • 7.3.2 Ribosomes
                                                                                                                                                                                                                                                                                                                          • 7.3.3 Translation in Prokaryotes
                                                                                                                                                                                                                                                                                                                            • 7.3.4 Bioinformatics
                                                                                                                                                                                                                                                                                                                              • 7.3.5 Levels of Protein Structure
                                                                                                                                                                                                                                                                                                                                • 7.3.6 Skills: Polysomes & Ribosomes
                                                                                                                                                                                                                                                                                                                              • 8. Metabolism, Cell Respiration & Photosynthesis (HL Only)
                                                                                                                                                                                                                                                                                                                                • 8.1 Metabolism
                                                                                                                                                                                                                                                                                                                                  • 8.1.1 Metabolic Pathways
                                                                                                                                                                                                                                                                                                                                    • 8.1.2 Inhibition
                                                                                                                                                                                                                                                                                                                                      • 8.1.3 Bioinformatics & Metabolism
                                                                                                                                                                                                                                                                                                                                        • 8.1.4 Skills: Rates of Reaction & Types of Inhibition
                                                                                                                                                                                                                                                                                                                                        • 8.2 Cell Respiration
                                                                                                                                                                                                                                                                                                                                          • 8.2.1 Oxidation, Reduction & Phosphorylation
                                                                                                                                                                                                                                                                                                                                            • 8.2.2 Overview of the Stages of Respiration
                                                                                                                                                                                                                                                                                                                                              • 8.2.3 Glycolysis
                                                                                                                                                                                                                                                                                                                                                • 8.2.4 The Link Reaction & The Krebs Cycle
                                                                                                                                                                                                                                                                                                                                                  • 8.2.5 Oxidative Phosphorylation
                                                                                                                                                                                                                                                                                                                                                    • 8.2.6 Mitochondria
                                                                                                                                                                                                                                                                                                                                                      • 8.2.7 Skills: Cell Respiration
                                                                                                                                                                                                                                                                                                                                                      • 8.3 Photosynthesis
                                                                                                                                                                                                                                                                                                                                                        • 8.3.1 Light-dependent Reactions
                                                                                                                                                                                                                                                                                                                                                          • 8.3.2 Photophosphorylation
                                                                                                                                                                                                                                                                                                                                                            • 8.3.3 Light-independent Reactions
                                                                                                                                                                                                                                                                                                                                                              • 8.3.4 Investigating Carbon Fixation in Photosynthesis
                                                                                                                                                                                                                                                                                                                                                                • 8.3.5 Chloroplast
                                                                                                                                                                                                                                                                                                                                                                  • 8.3.6 Skills: Photosynthesis
                                                                                                                                                                                                                                                                                                                                                                • 9. Plant Biology (HL Only)
                                                                                                                                                                                                                                                                                                                                                                  • 9.1 Transport in the Xylem of Plants
                                                                                                                                                                                                                                                                                                                                                                    • 9.1.1 Transpiration in Plants
                                                                                                                                                                                                                                                                                                                                                                      • 9.1.2 The Transpiration Stream
                                                                                                                                                                                                                                                                                                                                                                        • 9.1.3 The Roots & Water Transport
                                                                                                                                                                                                                                                                                                                                                                          • 9.1.4 Adaptations of Xerophytes
                                                                                                                                                                                                                                                                                                                                                                            • 9.1.5 Skills: Drawing Xylem Vessels
                                                                                                                                                                                                                                                                                                                                                                              • 9.1.6 Skills: Experiments Investigating the Rate of Transpiration
                                                                                                                                                                                                                                                                                                                                                                              • 9.2 Transport in the Phloem of Plants
                                                                                                                                                                                                                                                                                                                                                                                • 9.2.1 Translocation in Plants
                                                                                                                                                                                                                                                                                                                                                                                  • 9.2.2 Sucrose Loading
                                                                                                                                                                                                                                                                                                                                                                                    • 9.2.3 Hydrostatic Pressure Gradients
                                                                                                                                                                                                                                                                                                                                                                                      • 9.2.4 Skills: Identifying Xylem & Phloem
                                                                                                                                                                                                                                                                                                                                                                                        • 9.2.5 Skills: Measuring Phloem Transport Rates
                                                                                                                                                                                                                                                                                                                                                                                        • 9.3 Growth in Plants
                                                                                                                                                                                                                                                                                                                                                                                          • 9.3.1 Plant Growth
                                                                                                                                                                                                                                                                                                                                                                                            • 9.3.2 Plant Hormones
                                                                                                                                                                                                                                                                                                                                                                                              • 9.3.3 Micropropagation
                                                                                                                                                                                                                                                                                                                                                                                              • 9.4 Reproduction in Plants
                                                                                                                                                                                                                                                                                                                                                                                                • 9.4.1 Flowering
                                                                                                                                                                                                                                                                                                                                                                                                  • 9.4.2 Plant Reproduction
                                                                                                                                                                                                                                                                                                                                                                                                    • 9.4.3 Skills: Drawing Plant Structures
                                                                                                                                                                                                                                                                                                                                                                                                      • 9.4.4 Skills: Investigating Factors Affecting Germination
                                                                                                                                                                                                                                                                                                                                                                                                    • 10. Genetics & Evolution (HL Only)
                                                                                                                                                                                                                                                                                                                                                                                                      • 10.1 Meiosis
                                                                                                                                                                                                                                                                                                                                                                                                        • 10.1.1 The Process of Meiosis
                                                                                                                                                                                                                                                                                                                                                                                                          • 10.1.2 Crossing Over
                                                                                                                                                                                                                                                                                                                                                                                                            • 10.1.3 Meiosis I
                                                                                                                                                                                                                                                                                                                                                                                                              • 10.1.4 Meiosis II
                                                                                                                                                                                                                                                                                                                                                                                                                • 10.1.5 Skills: Drawing Chiasmata
                                                                                                                                                                                                                                                                                                                                                                                                                • 10.2 Inheritance
                                                                                                                                                                                                                                                                                                                                                                                                                  • 10.2.1 Unlinked Genes
                                                                                                                                                                                                                                                                                                                                                                                                                    • 10.2.2 Skills: Analysing Dihybrid Crosses
                                                                                                                                                                                                                                                                                                                                                                                                                      • 10.2.3 Gene Linkage
                                                                                                                                                                                                                                                                                                                                                                                                                        • 10.2.4 Skills: Identifying Recombinants
                                                                                                                                                                                                                                                                                                                                                                                                                          • 10.2.5 Skills: Chi-squared Test
                                                                                                                                                                                                                                                                                                                                                                                                                            • 10.2.6 Variation
                                                                                                                                                                                                                                                                                                                                                                                                                            • 10.3 Gene Pools & Speciation
                                                                                                                                                                                                                                                                                                                                                                                                                              • 10.3.1 Gene Pools
                                                                                                                                                                                                                                                                                                                                                                                                                                • 10.3.2 Evolution
                                                                                                                                                                                                                                                                                                                                                                                                                                  • 10.3.3 Speciation
                                                                                                                                                                                                                                                                                                                                                                                                                                    • 10.3.4 Polyploidy & Speciation
                                                                                                                                                                                                                                                                                                                                                                                                                                      • 10.3.5 Skills: Comparing Allele Frequencies Between Populations
                                                                                                                                                                                                                                                                                                                                                                                                                                    • 11. Animal Physiology (HL Only)
                                                                                                                                                                                                                                                                                                                                                                                                                                      • 11.1 Antibody Production & Vaccination
                                                                                                                                                                                                                                                                                                                                                                                                                                        • 11.1.1 Antigens
                                                                                                                                                                                                                                                                                                                                                                                                                                          • 11.1.2 Specific Immune Response
                                                                                                                                                                                                                                                                                                                                                                                                                                            • 11.1.3 Antibodies, Vaccines & Immunity
                                                                                                                                                                                                                                                                                                                                                                                                                                              • 11.1.4 Smallpox Vaccine & Eradication
                                                                                                                                                                                                                                                                                                                                                                                                                                                • 11.1.5 Zoonosis
                                                                                                                                                                                                                                                                                                                                                                                                                                                  • 11.1.6 Histamines
                                                                                                                                                                                                                                                                                                                                                                                                                                                    • 11.1.7 Monoclonal Antibodies
                                                                                                                                                                                                                                                                                                                                                                                                                                                      • 11.1.8 Skills: Analysing Epidemiological Data
                                                                                                                                                                                                                                                                                                                                                                                                                                                      • 11.2 Movement
                                                                                                                                                                                                                                                                                                                                                                                                                                                        • 11.2.1 Requirements for Movement
                                                                                                                                                                                                                                                                                                                                                                                                                                                          • 11.2.2 Skeletal Muscle
                                                                                                                                                                                                                                                                                                                                                                                                                                                            • 11.2.3 Mechanism of Muscle Contraction
                                                                                                                                                                                                                                                                                                                                                                                                                                                              • 11.2.4 Skills: The Human Elbow & Sarcomeres
                                                                                                                                                                                                                                                                                                                                                                                                                                                                • 11.2.5 Skills: Analysing Muscle Contractions in Electron Micrographs
                                                                                                                                                                                                                                                                                                                                                                                                                                                                • 11.3 The Kidney & Osmoregulation
                                                                                                                                                                                                                                                                                                                                                                                                                                                                  • 11.3.1 Osmoregulation in Organisms
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    • 11.3.2 Kidney: Structure & Function
                                                                                                                                                                                                                                                                                                                                                                                                                                                                      • 11.3.3 Conserving Water
                                                                                                                                                                                                                                                                                                                                                                                                                                                                        • 11.3.4 The Role of ADH
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          • 11.3.5 Types of Nitrogenous Waste
                                                                                                                                                                                                                                                                                                                                                                                                                                                                            • 11.3.6 Kidney Failure & Urinalysis
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              • 11.3.7 Skills: Drawing & Annotating the Kidney
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              • 11.4 Sexual Reproduction
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                • 11.4.1 Oogenesis & Spermatogenesis
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  • 11.4.2 Fertilisation
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    • 11.4.3 Pregnancy
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      • 11.4.4 Hormones in Pregnancy
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        • 11.4.5 The Placenta
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          • 11.4.6 Oestrogen Pollution
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            • 11.4.7 Skills: Annotating Sexual Reproduction Diagrams
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Phil Chatterton

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Author: Phil

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Phil graduated in Biochemistry from Birmingham University and spent seventeen years in the drinks and chemicals industries. He holds an MBA from Manchester Business School. More recently, Phil has taught in secondary schools, examined GCSE Biology and has also co-directed a tuition agency. He is a passionate believer in promoting numeracy in his teaching and loves to create innovative resources.


                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Save My Exams Logo
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Resources
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Home Join Support

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Members
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Members Home Account Logout

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Company
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          About Us Contact Us Jobs Terms Privacy Facebook Twitter

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          Quick Links
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCSE Revision Notes IGCSE Revision Notes A Level Revision Notes Biology Chemistry Physics Maths 2022 Advance Information

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          © IB Documents (2) Team & u/aimlesskr
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          IBO was not involved in the production of, and does not endorse, the resources created by Save My Exams.